Home  |  Contact

Cellosaurus JHOS-2 (CVCL_4647)

[Text version]

Cell line name JHOS-2
Synonyms JHOS2
Accession CVCL_4647
Resource Identification Initiative To cite this cell line use: JHOS-2 (RRID:CVCL_4647)
Comments Part of: Cancer Cell Line Encyclopedia (CCLE) project.
Part of: COSMIC cell lines project.
Population: Japanese.
Doubling time: 61 hours (PubMed=10695020).
Microsatellite instability: Stable (MSS) (Sanger).
Omics: Deep exome analysis.
Omics: Deep RNAseq analysis.
Omics: DNA methylation analysis.
Omics: Deep proteome analysis.
Omics: Genome sequenced.
Omics: SNP array analysis.
Omics: Transcriptome analysis.
Sequence variations Mutation; HGNC; 11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (CCLE; Cosmic-CLP).
Genome ancestry Source: PubMed=30894373

Origin% genome
Native American0.18
East Asian, North83.51
East Asian, South14.94
South Asian0.69
European, North0
European, South0.68
Disease High grade ovarian serous adenocarcinoma (NCIt: C105555)
Derived from metastatic site: Lymph node.
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): Cosmic-CLP; PubMed=30485824; RCB


Run an STR similarity search on this cell line

Yamada K., Tachibana T., Hashimoto H., Suzuki K., Yanagida S., Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Hum. Cell 12:131-138(1999)

PubMed=22460905; DOI=10.1038/nature11003
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=23839242; DOI=10.1038/ncomms3126
Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.
Evaluating cell lines as tumour models by comparison of genomic profiles.
Nat. Commun. 4:2126-2126(2013)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X., Egan R.K., Liu Q., Mironenko T., Mitropoulos X., Richardson L., Wang J., Zhang T., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

PubMed=27561551; DOI=10.1038/ncomms12645
Coscia F., Watters K.M., Curtis M., Eckert M.A., Chiang C.Y., Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Nat. Commun. 7:12645-12645(2016)

PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096
Papp E., Hallberg D., Konecny G.E., Bruhm D.C., Adleff V., Noe M., Kagiampakis I., Palsgrove D., Conklin D., Kinose Y., White J.R., Press M.F., Drapkin R.I., Easwaran H., Baylin S.B., Slamon D.J., Velculescu V.E., Scharpf R.B.
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Cell Rep. 25:2617-2633(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. III, Barretina J., Gelfand E.T., Bielski C.M., Li H., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

Cell line collections RCB; RCB1521
Cell line databases/resources CCLE; JHOS2_OVARY
Cell_Model_Passport; SIDM00305
Cosmic-CLP; 1479995
DepMap; ACH-000132
Ontologies CLO; CLO_0051440
Biological sample resources BioSample; SAMN03472150
BioSample; SAMN10988178
Chemistry resources GDSC; 1479995
PharmacoDB; JHOS2_689_2019
Gene expression databases ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
GEO; GSM711695
GEO; GSM887178
GEO; GSM888250
GEO; GSM1669955
Other Wikidata; Q54898657
Polymorphism and mutation databases Cosmic; 1066215
IARC_TP53; 28295
LiGeA; CCLE_154
Progenetix; CVCL_4647
Proteomic databases PRIDE; PXD003668
Entry history
Entry creation04-Apr-2012
Last entry update20-May-2021
Version number23