Home  |  Contact

Cellosaurus JHOS-2 (CVCL_4647)

Cell line name JHOS-2
Synonyms JHOS2
Accession CVCL_4647
Resource Identification Initiative To cite this cell line use: JHOS-2 (RRID:CVCL_4647)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Population: Japanese.
Doubling time: 61 hours (PubMed=10695020).
Microsatellite instability: Stable (MSS) (Sanger).
Omics: CRISPR phenotypic screen.
Omics: Deep exome analysis.
Omics: Deep quantitative proteome analysis.
Omics: DNA methylation analysis.
Omics: Deep proteome analysis.
Omics: Genome sequenced.
Omics: SNP array analysis.
Omics: Transcriptome analysis by microarray.
Omics: Transcriptome analysis by RNAseq.
Derived from site: Metastatic; Lymph node; UBERON=UBERON_0000027.
Sequence variations
  • Mutation; HGNC; 11998; TP53; Simple; c.767_782+4delTGACCTGGAGTCTTCCAGTG; Zygosity=Unspecified (Cosmic-CLP; DepMap).
Genome ancestry Source: PubMed=30894373

Origin% genome
African0
Native American0.18
East Asian, North83.51
East Asian, South14.94
South Asian0.69
European, North0
European, South0.68
Disease High grade ovarian serous adenocarcinoma (NCIt: C105555)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): Cosmic-CLP; PubMed=30485824; RCB

Markers:
AmelogeninX
CSF1PO11
D5S81810
D7S82011
D13S3178,9
D16S53913
D21S1131,31.2
TH016,7
TPOX8,11
vWA14,17

Run an STR similarity search on this cell line
Publications

PubMed=10695020
Yamada K., Tachibana T., Hashimoto H., Suzuki K., Yanagida S., Endoh H., Kimura E., Yasuda M., Tanaka T., Ishikawa H.
Establishment and characterization of cell lines derived from serous adenocarcinoma (JHOS-2) and clear cell adenocarcinoma (JHOC-5, JHOC-6) of human ovary.
Hum. Cell 12:131-138(1999)

PubMed=22460905; DOI=10.1038/nature11003
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M.L., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=23839242; DOI=10.1038/ncomms3126
Domcke S., Sinha R., Levine D.A., Sander C., Schultz N.
Evaluating cell lines as tumour models by comparison of genomic profiles.
Nat. Commun. 4:2126.1-2126.10(2013)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X., Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

PubMed=27561551; DOI=10.1038/ncomms12645
Coscia F., Watters K.M., Curtis M., Eckert M.A., Chiang C.Y., Tyanova S., Montag A., Lastra R.R., Lengyel E., Mann M.
Integrative proteomic profiling of ovarian cancer cell lines reveals precursor cell associated proteins and functional status.
Nat. Commun. 7:12645.1-12645.14(2016)

PubMed=30485824; DOI=10.1016/j.celrep.2018.10.096
Papp E., Hallberg D., Konecny G.E., Bruhm D.C., Adleff V., Noe M., Kagiampakis I., Palsgrove D., Conklin D., Kinose Y., White J.R., Press M.F., Drapkin R.I., Easwaran H., Baylin S.B., Slamon D.J., Velculescu V.E., Scharpf R.B.
Integrated genomic, epigenomic, and expression analyses of ovarian cancer cell lines.
Cell Rep. 25:2617-2633(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=30971826; DOI=10.1038/s41586-019-1103-9
Behan F.M., Iorio F., Picco G., Goncalves E., Beaver C.M., Migliardi G., Santos R., Rao Y., Sassi F., Pinnelli M., Ansari R., Harper S., Jackson D.A., McRae R., Pooley R., Wilkinson P., van der Meer D.J., Dow D., Buser-Doepner C.A., Bertotti A., Trusolino L., Stronach E.A., Saez-Rodriguez J., Yusa K., Garnett M.J.
Prioritization of cancer therapeutic targets using CRISPR-Cas9 screens.
Nature 568:511-516(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. III, Barretina J.G., Gelfand E.T., Bielski C.M., Li H.-X., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y.-L., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=35839778; DOI=10.1016/j.ccell.2022.06.010
Goncalves E., Poulos R.C., Cai Z.-X., Barthorpe S., Manda S.S., Lucas N., Beck A., Bucio-Noble D., Dausmann M., Hall C., Hecker M., Koh J., Lightfoot H., Mahboob S., Mali I., Morris J., Richardson L., Seneviratne A.J., Shepherd R., Sykes E., Thomas F., Valentini S., Williams S.G., Wu Y.-X., Xavier D., MacKenzie K.L., Hains P.G., Tully B., Robinson P.J., Zhong Q., Garnett M.J., Reddel R.R.
Pan-cancer proteomic map of 949 human cell lines.
Cancer Cell 40:835-849.e8(2022)

Cross-references
Cell line collections (Providers) RCB; RCB1521
Cell line databases/resources CLO; CLO_0051440
cancercelllines; CVCL_4647
Cell_Model_Passport; SIDM00305
Cosmic-CLP; 1479995
DepMap; ACH-000132
Biological sample resources BioSample; SAMN03472150
BioSample; SAMN10988178
CRISP screens repositories BioGRID_ORCS_Cell_line; 904
Chemistry resources GDSC; 1479995
PharmacoDB; JHOS2_689_2019
Encyclopedic resources Wikidata; Q54898657
Gene expression databases ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
GEO; GSM711695
GEO; GSM887178
GEO; GSM888250
GEO; GSM1669955
Polymorphism and mutation databases Cosmic; 1066215
IARC_TP53; 28295
LiGeA; CCLE_154
Progenetix; CVCL_4647
Proteomic databases PRIDE; PXD003668
PRIDE; PXD030304
Sequence databases EGA; EGAS00001000978
Entry history
Entry creation04-Apr-2012
Last entry update30-Jan-2024
Version number29