Home  |  Contact

Cellosaurus SNU-761 (CVCL_5089)

[Text version]

Cell line name SNU-761
Synonyms SNU761; NCI-SNU-761
Accession CVCL_5089
Resource Identification Initiative To cite this cell line use: SNU-761 (RRID:CVCL_5089)
Comments Part of: Cancer Cell Line Encyclopedia (CCLE) project.
Part of: Liver Cancer Model Repository (LIMORE).
Part of: Seoul National University (SNU) cell line collection.
Population: Korean.
Doubling time: 24 hours (PubMed=11819450); 24.32 hours (PubMed=31378681).
Transformant: NCBI_TaxID; 10407; Hepatitis B virus (HBV).
Omics: Deep exome analysis.
Omics: Deep RNAseq analysis.
Omics: Genome sequenced.
Omics: miRNA expression profiling.
Omics: Protein expression by reverse-phase protein arrays.
Omics: SNP array analysis.
Omics: Transcriptome analysis.
Sequence variations TP53 p.Ser313Glyfs*13 (c.937_968delAGCTCCTCTCCCCAGCCAAAGAAGAAACCACT) (PubMed=8824565; PubMed=31378681).
Genome ancestry Source: PubMed=30894373

Origin% genome
African0.61
Native American0
East Asian, North59.84
East Asian, South38.16
South Asian0
European, North0
European, South1.38
Disease Adult hepatocellular carcinoma (NCIt: C7956)
Adult hepatocellular carcinoma (ORDO: Orphanet_210159)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Sex of cell Male
Age at sampling 49Y
Category Cancer cell line
STR profile Source(s): KCLB; PubMed=31378681

Markers:
AmelogeninX,Y
CSF1PO12
D3S135815,17
D5S8189,12
D7S8209
D13S31710
D16S53911
FGA23,24
TH019
TPOX11
vWA16

Run an STR similarity search on this cell line
Web pages https://lccl.zucmanlab.com/hcc/cellLines/SNU761
Publications

PubMed=8824565; DOI=10.1002/(SICI)1097-0215(19960917)67:6<898::AID-IJC22>3.0.CO;2-X
Kang M.-S., Lee H.-J., Lee J.-H., Ku J.-L., Lee K.P., Kelley M.J., Won Y.-J., Kim S.-T., Park J.-G.
Mutation of p53 gene in hepatocellular carcinoma cell lines with HBX DNA.
Int. J. Cancer 67:898-902(1996)

PubMed=11819450; DOI=10.3748/wjg.v5.i4.289
Lee J.-H., Ku J.-L., Park Y.-J., Lee K.-U., Kim W.-H., Park J.-G.
Establishment and characterization of four human hepatocellular carcinoma cell lines containing hepatitis B virus DNA.
World J. Gastroenterol. 5:289-295(1999)

PubMed=19956504; DOI=10.4143/crt.2005.37.1.1
Ku J.-L., Park J.-G.
Biology of SNU cell lines.
Cancer Res. Treat. 37:1-19(2005)

PubMed=22460905; DOI=10.1038/nature11003
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.K., Yu J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747
Dutil J., Chen Z., Monteiro A.N., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=31063779; DOI=10.1053/j.gastro.2019.05.001
Caruso S., Calatayud A.-L., Pilet J., La Bella T., Rekik S., Imbeaud S., Letouze E., Meunier L., Bayard Q., Rohr-Udilova N., Peneau C., Grasl-Kraupp B., de Koning L., Ouine B., Bioulac-Sage P., Couchy G., Calderaro J., Nault J.-C., Zucman-Rossi J., Rebouissou S.
Analysis of liver cancer cell lines identifies agents with likely efficacy against hepatocellular carcinoma and markers of response.
Gastroenterology 157:760-776(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. III, Barretina J., Gelfand E.T., Bielski C.M., Li H., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=31378681; DOI=10.1016/j.ccell.2019.07.001
Qiu Z.-X., Li H., Zhang Z.-T., Zhu Z.-F., He S., Wang X.-J., Wang P.-C., Qin J.-J., Zhuang L.-P., Wang W., Xie F.-B., Gu Y., Zou K.-K., Li C., Li C., Wang C.-H., Cen J., Chen X.-T., Shu Y.-J., Zhang Z., Sun L.-L., Min L.-H., Fu Y., Huang X.-W., Lv H., Zhou H., Ji Y., Zhang Z.-G., Meng Z.-Q., Shi X.-L., Zhang H.-B., Li Y.-X., Hui L.-J.
A pharmacogenomic landscape in human liver cancers.
Cancer Cell 36:179-193.e11(2019)

Cross-references
Cell line collections KCLB; 00761
Cell line databases/resources CCLE; SNU761_LIVER
Cell_Model_Passport; SIDM01439
DepMap; ACH-000537
LIMORE; SNU761
Biological sample resources BioSample; SAMN10987730
Chemistry resources PharmacoDB; SNU761_1481_2019
Gene expression databases ArrayExpress; E-MTAB-2770
GEO; GSM887639
GEO; GSM888729
GEO; GSM1374899
GEO; GSM2551592
Other Wikidata; Q54955261
Polymorphism and mutation databases Cosmic; 2771601
IARC_TP53; 6312
LiGeA; CCLE_397
Progenetix; CVCL_5089
Entry history
Entry creation04-Apr-2012
Last entry update29-Oct-2020
Version number20