Home  |  Contact
Due to scheduled maintenance work, this service will not be available from Tuesday August 23rd 06:00 pm until Wednesday August 24th 08:00 am CEST. Apologies for the inconvenience.

Cellosaurus MM1.S (CVCL_8792)

[Text version]

Cell line name MM1.S
Synonyms MM.1S; MM1-S; MM-1S; MM1S
Accession CVCL_8792
Resource Identification Initiative To cite this cell line use: MM1.S (RRID:CVCL_8792)
Comments Part of: Cancer Dependency Map project (DepMap) (includes Cancer Cell Line Encyclopedia - CCLE).
Part of: COSMIC cell lines project.
Part of: MD Anderson Cell Lines Project.
Population: African American.
Characteristics: Produces IgA lambda.
Characteristics: Sensitive to dexamethasone.
Doubling time: 80 hours (PubMed=25984343).
Microsatellite instability: Instable (MSI-low) (Sanger).
Omics: Array-based CGH.
Omics: Deep exome analysis.
Omics: Deep RNAseq analysis.
Omics: DNA methylation analysis.
Omics: Protein expression by reverse-phase protein arrays.
Omics: shRNA library screening.
Omics: SNP array analysis.
Omics: Transcriptome analysis.
Derived from sampling site: Peripheral blood.
Sequence variations
  • Mutation; HGNC; 6407; KRAS; Simple; p.Gly12Ala (c.35G>C); ClinVar=VCV000045122; Zygosity=Heterozygous (PubMed=21173094; Cosmic-CLP; DepMap).
  • Mutation; HGNC; 12033; TRAF3; Simple; p.Val536_Asn545delValPheValAlaGlnThrValLeuGluAsninsAsp (c.1604-1630delTCTTTGTGGCCCAAACTGTTCTAGAAA); Zygosity=Homozygous (PubMed=17692805).
HLA typing Source: PubMed=25688540
Class I
Genome ancestry Source: PubMed=30894373

Origin% genome
Native American0
East Asian, North4.01
East Asian, South0
South Asian0.43
European, North0
European, South6.87
Disease Plasma cell myeloma (NCIt: C3242)
Multiple myeloma (ORDO: Orphanet_29073)
Species of origin Homo sapiens (Human) (NCBI Taxonomy: 9606)
Hierarchy Parent: CVCL_5801 (MM.1)
CVCL_B7F7 (MM.1S-luc )
Sex of cell Female
Age at sampling 45Y
Category Cancer cell line
STR profile Source(s): ATCC; Cosmic-CLP; Genomics_Center_BCF_Technion; PubMed=25877200

Penta D2.2,9
Penta E13,15

Run an STR similarity search on this cell line
Web pages https://www.keatslab.org/myeloma-cell-lines/hmcl-characteristics

PubMed=12691914; DOI=10.1016/S0301-472X(03)00023-7
Greenstein S., Krett N.L., Kurosawa Y., Ma C., Chauhan D., Hideshima T., Anderson K.C., Rosen S.T.
Characterization of the MM.1 human multiple myeloma (MM) cell lines: a model system to elucidate the characteristics, behavior, and signaling of steroid-sensitive and -resistant MM cells.
Exp. Hematol. 31:271-282(2003)

PubMed=14760100; DOI=10.1158/1078-0432.ccr-0793-03
Shammas M.A., Shmookler Reis R.J., Li C., Koley H., Hurley L.H., Anderson K.C., Munshi N.C.
Telomerase inhibition and cell growth arrest after telomestatin treatment in multiple myeloma.
Clin. Cancer Res. 10:770-776(2004)

Bataille R., Jego G., Robillard N., Barille-Nion S., Harousseau J.-L., Moreau P., Amiot M., Pellat-Deceunynck C.
The phenotype of normal, reactive and malignant plasma cells Identification of 'many and multiple myelomas' and of new targets for myeloma therapy.
Haematologica 91:1234-1240(2006)

PubMed=17692805; DOI=10.1016/j.ccr.2007.07.003
Keats J.J., Fonseca R., Chesi M., Schop R., Baker A., Chng W.-J., Van Wier S., Tiedemann R., Shi C.-X., Sebag M., Braggio E., Henry T., Zhu Y.-X., Fogle H., Price-Troska T.L., Ahmann G.J., Mancini C., Brents L.A., Kumar S., Greipp P., Dispenzieri A., Bryant B., Mulligan G., Bruhn L., Barrett M.T., Valdez R., Trent J.M., Stewart A.K., Carpten J., Bergsagel P.L.
Promiscuous mutations activate the noncanonical NF-kappaB pathway in multiple myeloma.
Cancer Cell 12:131-144(2007)

PubMed=18647998; DOI=10.1093/jncimonographs/lgn011
Dib A., Gabrea A., Glebov O.K., Bergsagel P.L., Kuehl W.M.
Characterization of MYC translocations in multiple myeloma cell lines.
J. Natl. Cancer Inst. Monogr. 39:25-31(2008)

PubMed=21173094; DOI=10.3324/haematol.2010.033456
Moreaux J., Klein B., Bataille R., Descamps G., Maiga S., Hose D., Goldschmidt H., Jauch A., Reme T., Jourdan M., Amiot M., Pellat-Deceunynck C.
A high-risk signature for patients with multiple myeloma established from the molecular classification of human myeloma cell lines.
Haematologica 96:574-582(2011)

PubMed=22460905; DOI=10.1038/nature11003
Barretina J.G., Caponigro G., Stransky N., Venkatesan K., Margolin A.A., Kim S., Wilson C.J., Lehar J., Kryukov G.V., Sonkin D., Reddy A., Liu M., Murray L., Berger M.F., Monahan J.E., Morais P., Meltzer J., Korejwa A., Jane-Valbuena J., Mapa F.A., Thibault J., Bric-Furlong E., Raman P., Shipway A., Engels I.H., Cheng J., Yu G.-Y.K., Yu J.-J., Aspesi P. Jr., de Silva M., Jagtap K., Jones M.D., Wang L., Hatton C., Palescandolo E., Gupta S., Mahan S., Sougnez C., Onofrio R.C., Liefeld T., MacConaill L.E., Winckler W., Reich M., Li N.-X., Mesirov J.P., Gabriel S.B., Getz G., Ardlie K., Chan V., Myer V.E., Weber B.L., Porter J., Warmuth M., Finan P., Harris J.L., Meyerson M., Golub T.R., Morrissey M.P., Sellers W.R., Schlegel R., Garraway L.A.
The Cancer Cell Line Encyclopedia enables predictive modelling of anticancer drug sensitivity.
Nature 483:603-607(2012)

PubMed=25984343; DOI=10.1038/sdata.2014.35
Cowley G.S., Weir B.A., Vazquez F., Tamayo P., Scott J.A., Rusin S., East-Seletsky A., Ali L.D., Gerath W.F.J., Pantel S.E., Lizotte P.H., Jiang G.-Z., Hsiao J., Tsherniak A., Dwinell E., Aoyama S., Okamoto M., Harrington W., Gelfand E.T., Green T.M., Tomko M.J., Gopal S., Wong T.C., Li H.-B., Howell S., Stransky N., Liefeld T., Jang D., Bistline J., Meyers B.H., Armstrong S.A., Anderson K.C., Stegmaier K., Reich M., Pellman D., Boehm J.S., Mesirov J.P., Golub T.R., Root D.E., Hahn W.C.
Parallel genome-scale loss of function screens in 216 cancer cell lines for the identification of context-specific genetic dependencies.
Sci. Data 1:140035-140035(2014)

PubMed=25485619; DOI=10.1038/nbt.3080
Klijn C., Durinck S., Stawiski E.W., Haverty P.M., Jiang Z.-S., Liu H.-B., Degenhardt J., Mayba O., Gnad F., Liu J.-F., Pau G., Reeder J., Cao Y., Mukhyala K., Selvaraj S.K., Yu M.-M., Zynda G.J., Brauer M.J., Wu T.D., Gentleman R.C., Manning G., Yauch R.L., Bourgon R., Stokoe D., Modrusan Z., Neve R.M., de Sauvage F.J., Settleman J., Seshagiri S., Zhang Z.-M.
A comprehensive transcriptional portrait of human cancer cell lines.
Nat. Biotechnol. 33:306-312(2015)

PubMed=25688540; DOI=10.1002/cyto.a.22643
Maiga S., Brosseau C., Descamps G., Dousset C., Gomez-Bougie P., Chiron D., Menoret E., Kervoelen C., Vie H., Cesbron A., Moreau-Aubry A., Amiot M., Pellat-Deceunynck C.
A simple flow cytometry-based barcode for routine authentication of multiple myeloma and mantle cell lymphoma cell lines.
Cytometry A 87:285-288(2015)

PubMed=27397505; DOI=10.1016/j.cell.2016.06.017
Iorio F., Knijnenburg T.A., Vis D.J., Bignell G.R., Menden M.P., Schubert M., Aben N., Goncalves E., Barthorpe S., Lightfoot H., Cokelaer T., Greninger P., van Dyk E., Chang H., de Silva H., Heyn H., Deng X.-M., Egan R.K., Liu Q.-S., Mironenko T., Mitropoulos X., Richardson L., Wang J.-H., Zhang T.-H., Moran S., Sayols S., Soleimani M., Tamborero D., Lopez-Bigas N., Ross-Macdonald P., Esteller M., Gray N.S., Haber D.A., Stratton M.R., Benes C.H., Wessels L.F.A., Saez-Rodriguez J., McDermott U., Garnett M.J.
A landscape of pharmacogenomic interactions in cancer.
Cell 166:740-754(2016)

Chow S.
Targeted capture and sequencing of immunoglobulin rearrangements in multiple myeloma to enable detection of minimal residual disease.
Thesis MSc (2017), University of Toronto, Canada

PubMed=28196595; DOI=10.1016/j.ccell.2017.01.005
Li J., Zhao W., Akbani R., Liu W.-B., Ju Z.-L., Ling S.-Y., Vellano C.P., Roebuck P., Yu Q.-H., Eterovic A.K., Byers L.A., Davies M.A., Deng W.-L., Gopal Y.N.V., Chen G., von Euw E.M., Slamon D.J., Conklin D., Heymach J.V., Gazdar A.F., Minna J.D., Myers J.N., Lu Y.-L., Mills G.B., Liang H.
Characterization of human cancer cell lines by reverse-phase protein arrays.
Cancer Cell 31:225-239(2017)

PubMed=30285677; DOI=10.1186/s12885-018-4840-5
Tan K.-T., Ding L.-W., Sun Q.-Y., Lao Z.-T., Chien W., Ren X., Xiao J.-F., Loh X.-Y., Xu L., Lill M., Mayakonda A., Lin D.-C., Yang H., Koeffler H.P.
Profiling the B/T cell receptor repertoire of lymphocyte derived cell lines.
BMC Cancer 18:940.1-940.13(2018)

PubMed=30545397; DOI=10.1186/s13045-018-0679-0
Tessoulin B., Moreau-Aubry A., Descamps G., Gomez-Bougie P., Maiga S., Gaignard A., Chiron D., Menoret E., Le Gouill S., Moreau P., Amiot M., Pellat-Deceunynck C.
Whole-exon sequencing of human myeloma cell lines shows mutations related to myeloma patients at relapse with major hits in the DNA regulation and repair pathways.
J. Hematol. Oncol. 11:137.1-137.13(2018)

PubMed=30894373; DOI=10.1158/0008-5472.CAN-18-2747
Dutil J., Chen Z.-H., Monteiro A.N.A., Teer J.K., Eschrich S.A.
An interactive resource to probe genetic diversity and estimated ancestry in cancer cell lines.
Cancer Res. 79:1263-1273(2019)

PubMed=31068700; DOI=10.1038/s41586-019-1186-3
Ghandi M., Huang F.W., Jane-Valbuena J., Kryukov G.V., Lo C.C., McDonald E.R. III, Barretina J., Gelfand E.T., Bielski C.M., Li H., Hu K., Andreev-Drakhlin A.Y., Kim J., Hess J.M., Haas B.J., Aguet F., Weir B.A., Rothberg M.V., Paolella B.R., Lawrence M.S., Akbani R., Lu Y., Tiv H.L., Gokhale P.C., de Weck A., Mansour A.A., Oh C., Shih J., Hadi K., Rosen Y., Bistline J., Venkatesan K., Reddy A., Sonkin D., Liu M., Lehar J., Korn J.M., Porter D.A., Jones M.D., Golji J., Caponigro G., Taylor J.E., Dunning C.M., Creech A.L., Warren A.C., McFarland J.M., Zamanighomi M., Kauffmann A., Stransky N., Imielinski M., Maruvka Y.E., Cherniack A.D., Tsherniak A., Vazquez F., Jaffe J.D., Lane A.A., Weinstock D.M., Johannessen C.M., Morrissey M.P., Stegmeier F., Schlegel R., Hahn W.C., Getz G., Mills G.B., Boehm J.S., Golub T.R., Garraway L.A., Sellers W.R.
Next-generation characterization of the Cancer Cell Line Encyclopedia.
Nature 569:503-508(2019)

PubMed=32123307; DOI=10.1038/s41375-020-0785-1
Sarin V., Yu K., Ferguson I.D., Gugliemini O., Nix M.A., Hann B., Sirota M., Wiita A.P.
Evaluating the efficacy of multiple myeloma cell lines as models for patient tumors via transcriptomic correlation analysis.
Leukemia 34:2754-2765(2020)

Cell line collections ATCC; CRL-2974
Cell line databases/resources CLO; CLO_0037203
CCRID; 1101HUM-PUMC000680
Cell_Model_Passport; SIDM01265
Cosmic-CLP; 1659818
DepMap; ACH-000763
Lonza; 168
Anatomy/cell type resources BTO; BTO:0003933
Biological sample resources BioSample; SAMN03471684
BioSample; SAMN10988254
Chemistry resources GDSC; 1659818
PharmacoDB; MM1S_944_2019
Encyclopedic resources Wikidata; Q54906038
Experimental variables resources EFO; EFO_0005724
Gene expression databases ArrayExpress; E-MTAB-2706
ArrayExpress; E-MTAB-2770
ArrayExpress; E-MTAB-3610
ArrayExpress; E-TABM-1088
GEO; GSM562814
GEO; GSM887328
GEO; GSM888404
GEO; GSM1374685
GEO; GSM1666388
GEO; GSM1670118
Polymorphism and mutation databases Cosmic; 1424218
Cosmic; 1483077
Cosmic; 1762460
Cosmic; 1889512
Cosmic; 2081430
Cosmic; 2391805
Cosmic; 2809756
IARC_TP53; 28513
LiGeA; CCLE_132
Progenetix; CVCL_8792
Sequence databases EGA; EGAS00001000610
EGA; EGAS00001000978
Entry history
Entry creation06-Jun-2012
Last entry update23-Jun-2022
Version number28